|
ATCC
ygr127wδ strain recombinant dna reagent prs313 ygr127w Ygr127wδ Strain Recombinant Dna Reagent Prs313 Ygr127w, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ygr127wδ strain recombinant dna reagent prs313 ygr127w/product/ATCC Average 91 stars, based on 1 article reviews
ygr127wδ strain recombinant dna reagent prs313 ygr127w - by Bioz Stars,
2026-06
91/100 stars
|
Buy from Supplier |
|
Thermo Fisher
thermo fisher r78007 recombinant dna reagent resource reference Thermo Fisher R78007 Recombinant Dna Reagent Resource Reference, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/thermo fisher r78007 recombinant dna reagent resource reference/product/Thermo Fisher Average 99 stars, based on 1 article reviews
thermo fisher r78007 recombinant dna reagent resource reference - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
|
Merck & Co
2015 recombinant dna n a reagent resource reference 2015 Recombinant Dna N A Reagent Resource Reference, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/2015 recombinant dna n a reagent resource reference/product/Merck & Co Average 86 stars, based on 1 article reviews
2015 recombinant dna n a reagent resource reference - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
214488 recombinant dna reagent lakritz forward primer ccggaattacatcccaagaac kay 214488 Recombinant Dna Reagent Lakritz Forward Primer Ccggaattacatcccaagaac Kay, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/214488 recombinant dna reagent lakritz forward primer ccggaattacatcccaagaac kay/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
214488 recombinant dna reagent lakritz forward primer ccggaattacatcccaagaac kay - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Addgene inc
n2xstrep ires puro addgene rrid addgene 141391 recombinant dna reagent pet29a N2xstrep Ires Puro Addgene Rrid Addgene 141391 Recombinant Dna Reagent Pet29a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/n2xstrep ires puro addgene rrid addgene 141391 recombinant dna reagent pet29a/product/Addgene inc Average 93 stars, based on 1 article reviews
n2xstrep ires puro addgene rrid addgene 141391 recombinant dna reagent pet29a - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Addgene inc
m2xstrep ires puro addgene rrid addgene 141386 recombinant dna reagent plvx ef1alpha sars cov M2xstrep Ires Puro Addgene Rrid Addgene 141386 Recombinant Dna Reagent Plvx Ef1alpha Sars Cov, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/m2xstrep ires puro addgene rrid addgene 141386 recombinant dna reagent plvx ef1alpha sars cov/product/Addgene inc Average 93 stars, based on 1 article reviews
m2xstrep ires puro addgene rrid addgene 141386 recombinant dna reagent plvx ef1alpha sars cov - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Addgene inc
e2xstrep ires puro addgene rrid addgene 141385 recombinant dna reagent plvx ef1alpha sars cov E2xstrep Ires Puro Addgene Rrid Addgene 141385 Recombinant Dna Reagent Plvx Ef1alpha Sars Cov, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/e2xstrep ires puro addgene rrid addgene 141385 recombinant dna reagent plvx ef1alpha sars cov/product/Addgene inc Average 93 stars, based on 1 article reviews
e2xstrep ires puro addgene rrid addgene 141385 recombinant dna reagent plvx ef1alpha sars cov - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Addgene inc
paav cag backbone recombinant dna reagent paav cag ftacr eyfp plasmid Paav Cag Backbone Recombinant Dna Reagent Paav Cag Ftacr Eyfp Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/paav cag backbone recombinant dna reagent paav cag ftacr eyfp plasmid/product/Addgene inc Average 93 stars, based on 1 article reviews
paav cag backbone recombinant dna reagent paav cag ftacr eyfp plasmid - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pcdna3 1 backbone recombinant dna reagent paav cag ansacr eyfp plasmid Pcdna3 1 Backbone Recombinant Dna Reagent Paav Cag Ansacr Eyfp Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcdna3 1 backbone recombinant dna reagent paav cag ansacr eyfp plasmid/product/Addgene inc Average 93 stars, based on 1 article reviews
pcdna3 1 backbone recombinant dna reagent paav cag ansacr eyfp plasmid - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pcdna3 1 backbone recombinant dna reagent nlccr pcdna3 1 plasmid Pcdna3 1 Backbone Recombinant Dna Reagent Nlccr Pcdna3 1 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcdna3 1 backbone recombinant dna reagent nlccr pcdna3 1 plasmid/product/Addgene inc Average 93 stars, based on 1 article reviews
pcdna3 1 backbone recombinant dna reagent nlccr pcdna3 1 plasmid - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |