Review





Similar Products

91
ATCC ygr127wδ strain recombinant dna reagent prs313 ygr127w
Ygr127wδ Strain Recombinant Dna Reagent Prs313 Ygr127w, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ygr127wδ strain recombinant dna reagent prs313 ygr127w/product/ATCC
Average 91 stars, based on 1 article reviews
ygr127wδ strain recombinant dna reagent prs313 ygr127w - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier

99
Thermo Fisher thermo fisher r78007 recombinant dna reagent resource reference
Thermo Fisher R78007 Recombinant Dna Reagent Resource Reference, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/thermo fisher r78007 recombinant dna reagent resource reference/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
thermo fisher r78007 recombinant dna reagent resource reference - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

86
Merck & Co 2015 recombinant dna n a reagent resource reference
2015 Recombinant Dna N A Reagent Resource Reference, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/2015 recombinant dna n a reagent resource reference/product/Merck & Co
Average 86 stars, based on 1 article reviews
2015 recombinant dna n a reagent resource reference - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology 214488 recombinant dna reagent lakritz forward primer ccggaattacatcccaagaac kay
214488 Recombinant Dna Reagent Lakritz Forward Primer Ccggaattacatcccaagaac Kay, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/214488 recombinant dna reagent lakritz forward primer ccggaattacatcccaagaac kay/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
214488 recombinant dna reagent lakritz forward primer ccggaattacatcccaagaac kay - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Addgene inc n2xstrep ires puro addgene rrid addgene 141391 recombinant dna reagent pet29a
N2xstrep Ires Puro Addgene Rrid Addgene 141391 Recombinant Dna Reagent Pet29a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/n2xstrep ires puro addgene rrid addgene 141391 recombinant dna reagent pet29a/product/Addgene inc
Average 93 stars, based on 1 article reviews
n2xstrep ires puro addgene rrid addgene 141391 recombinant dna reagent pet29a - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Addgene inc m2xstrep ires puro addgene rrid addgene 141386 recombinant dna reagent plvx ef1alpha sars cov
M2xstrep Ires Puro Addgene Rrid Addgene 141386 Recombinant Dna Reagent Plvx Ef1alpha Sars Cov, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m2xstrep ires puro addgene rrid addgene 141386 recombinant dna reagent plvx ef1alpha sars cov/product/Addgene inc
Average 93 stars, based on 1 article reviews
m2xstrep ires puro addgene rrid addgene 141386 recombinant dna reagent plvx ef1alpha sars cov - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Addgene inc e2xstrep ires puro addgene rrid addgene 141385 recombinant dna reagent plvx ef1alpha sars cov
E2xstrep Ires Puro Addgene Rrid Addgene 141385 Recombinant Dna Reagent Plvx Ef1alpha Sars Cov, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/e2xstrep ires puro addgene rrid addgene 141385 recombinant dna reagent plvx ef1alpha sars cov/product/Addgene inc
Average 93 stars, based on 1 article reviews
e2xstrep ires puro addgene rrid addgene 141385 recombinant dna reagent plvx ef1alpha sars cov - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Addgene inc paav cag backbone recombinant dna reagent paav cag ftacr eyfp plasmid
Paav Cag Backbone Recombinant Dna Reagent Paav Cag Ftacr Eyfp Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paav cag backbone recombinant dna reagent paav cag ftacr eyfp plasmid/product/Addgene inc
Average 93 stars, based on 1 article reviews
paav cag backbone recombinant dna reagent paav cag ftacr eyfp plasmid - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Addgene inc pcdna3 1 backbone recombinant dna reagent paav cag ansacr eyfp plasmid
Pcdna3 1 Backbone Recombinant Dna Reagent Paav Cag Ansacr Eyfp Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcdna3 1 backbone recombinant dna reagent paav cag ansacr eyfp plasmid/product/Addgene inc
Average 93 stars, based on 1 article reviews
pcdna3 1 backbone recombinant dna reagent paav cag ansacr eyfp plasmid - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Addgene inc pcdna3 1 backbone recombinant dna reagent nlccr pcdna3 1 plasmid
Pcdna3 1 Backbone Recombinant Dna Reagent Nlccr Pcdna3 1 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcdna3 1 backbone recombinant dna reagent nlccr pcdna3 1 plasmid/product/Addgene inc
Average 93 stars, based on 1 article reviews
pcdna3 1 backbone recombinant dna reagent nlccr pcdna3 1 plasmid - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

Image Search Results